Details of Primer Pair 'ABC06005_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC06005_L01R01433Nils Rostoks2004-01-26 ABC06005_L01 CAACCACCCCATCTTCAGCC 1797 20 Nils Rostoks 2004-01-26 Illumina
ABC06005_R01 CAACTGCGCAATTAAGCGGA 2229 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC06005_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes