Details of Primer Pair 'ABC06018_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC06018_L01R01523Nils Rostoks2004-01-26 ABC06018_L01 TACAAAAGGATCCCGCCGAA 1447 20 Nils Rostoks 2004-01-26 Illumina
ABC06018_R01 GCCGCCTAATAACCATGGCA 1969 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC06018_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes