Details of Primer Pair 'ABC06074_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC06074_L01R01455Nils Rostoks2004-01-26 ABC06074_L01 GCCGTGAACCCCAAGATGAG 250 20 Nils Rostoks 2004-01-26 Illumina
ABC06074_R01 CGCTGTTCGCACACAAGCTC 704 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC06074_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes