Details of Primer Pair 'ABC06091_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC06091_L01R01465Nils Rostoks2004-01-26 ABC06091_L01 CTCAGCCACAACCGCATCAG 906 20 Nils Rostoks 2004-01-26 Illumina
ABC06091_R01 GAAGCGCATCTCCAGACGGT 1370 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC06091_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes