Details of Primer Pair 'ABC06096_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC06096_L01R01436Nils Rostoks2004-01-26 ABC06096_L01 AGTCCACGGGCAAAGAGCAG 1672 20 Nils Rostoks 2004-01-26 Illumina
ABC06096_R01 ATCTTGGCCTCCTTGGGGTC 2107 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC06096_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes