Details of Primer Pair 'ABC06130_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC06130_L01R01569Nils Rostoks2004-01-26 ABC06130_L01 GACGTCCCTCGCGTAAATGG 1194 20 Nils Rostoks 2004-01-26 Illumina
ABC06130_R01 TTGGCCGGGAACTTATGGTG 1762 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC06130_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes