Details of Primer Pair 'ABC06144_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC06144_L01R01152Nils Rostoks2005-03-17 ABC06144_L01 TTGCAAACAATTGTACCAGATG 1747 22 Nils Rostoks 2005-03-17 Invitrogen
ABC06144_R01 CCTTGTGCCTTAGGGTTCAG 1595 20 Nils Rostoks 2005-03-17 Invitrogen

Comment History of 'ABC06144_L01R01'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB