Details of Primer Pair 'ABC06150_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC06150_L01R01434Nils Rostoks2004-01-26 ABC06150_L01 TGGGTGGACAAGACCTGCAA 411 20 Nils Rostoks 2004-01-26 Illumina
ABC06150_R01 AGCCTAGGGCTTGAGGAGCA 844 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC06150_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes