Details of Primer Pair 'ABC06154_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC06154_L01R01402Nils Rostoks2004-01-26 ABC06154_L01 CACACGTTGTGGAAGACGGG 1164 20 Nils Rostoks 2004-01-26 Illumina
ABC06154_R01 TCTTGGAAAGCTGCAGCCAG 1565 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC06154_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes