Details of Primer Pair 'ABC06172_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC06172_L01R01521Nils Rostoks2004-01-26 ABC06172_L01 GGGACATGCATGGTGGCATA 843 20 Nils Rostoks 2004-01-26 Illumina
ABC06172_R01 GAATCTACCACCGCTCCAGCA 1363 21 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC06172_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes