Details of Primer Pair 'ABC06204_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC06204_L01R01416Nils Rostoks2004-01-26 ABC06204_L01 TCAAAGTGGGCAGGCATCAA 855 20 Nils Rostoks 2004-01-26 Illumina
ABC06204_R01 ATCATGACCCGATGCGGTG 1270 19 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC06204_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes