Details of Primer Pair 'ABC06208_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC06208_L01R01505Nils Rostoks2004-01-26 ABC06208_L01 GAGCAAGAGCAACTTCGCCC 948 20 Nils Rostoks 2004-01-26 Illumina
ABC06208_R01 GACGATTCCAACATGCCTGC 1452 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC06208_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes