Details of Primer Pair 'ABC06247_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC06247_L01R01577Nils Rostoks2004-01-26 ABC06247_L01 TCTAGACAAGAACCGCCCGC 995 20 Nils Rostoks 2004-01-26 Illumina
ABC06247_R01 CTCTGACATGGCTCTCGGCA 1571 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC06247_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes