Details of Primer Pair 'ABC06249_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC06249_L01R01427Nils Rostoks2004-01-26 ABC06249_L01 CCGCCACTAGAGAATCCCCC 803 20 Nils Rostoks 2004-01-26 Illumina
ABC06249_R01 CACCCATGCCTTCCTTTTGA 1229 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC06249_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes