Details of Primer Pair 'ABC06274_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC06274_L01R01401Nils Rostoks2004-01-26 ABC06274_L01 TGGCTCACAGTGCCATCCAT 1417 20 Nils Rostoks 2004-01-26 Illumina
ABC06274_R01 TCGAAACAAAACTGCGTGGC 1817 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC06274_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes