Details of Primer Pair 'ABC06282_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC06282_L01R01497Nils Rostoks2004-01-26 ABC06282_L01 CACGCACCAACTGCTCTGCT 1559 20 Nils Rostoks 2004-01-26 Illumina
ABC06282_R01 GTGGGCTGGACCGTTTGACT 2055 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC06282_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes