Details of Primer Pair 'ABC06322_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC06322_L01R01408Nils Rostoks2004-01-26 ABC06322_L01 AGGTCCTGGGCCACATGAAA 1058 20 Nils Rostoks 2004-01-26 Illumina
ABC06322_R01 ACTCCACCCAGCAAGCAAGG 1465 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC06322_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes