Details of Primer Pair 'ABC06343_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC06343_L01R01400Nils Rostoks2004-01-26 ABC06343_L01 AGGTGTGCATCGCTTCCTCC 1621 20 Nils Rostoks 2004-01-26 Illumina
ABC06343_R01 CAACACGGGCCAAACCAAAT 2020 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC06343_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes