Details of Primer Pair 'ABC06351_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC06351_L01R01441Nils Rostoks2004-01-26 ABC06351_L01 GGCGCATTTTGTGTGGACAG 1287 20 Nils Rostoks 2004-01-26 Illumina
ABC06351_R01 GCCACCACAACCGGGTACAT 1727 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC06351_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes