Details of Primer Pair 'ABC06358_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC06358_L01R01470Nils Rostoks2004-01-26 ABC06358_L01 AGCGCTCAGCAGGTTCCCT 534 19 Nils Rostoks 2004-01-26 Illumina
ABC06358_R01 GATGCACAGGGCACAGTTCG 1003 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC06358_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes