Details of Primer Pair 'ABC06372_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC06372_L01R01466Nils Rostoks2004-01-26 ABC06372_L01 CAACCTGCTCTTCGCCATCC 329 20 Nils Rostoks 2004-01-26 Illumina
ABC06372_R01 CTCGTTGATCTTGTCCCCGC 794 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC06372_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes