Details of Primer Pair 'ABC06381_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC06381_L01R01531Nils Rostoks2004-01-26 ABC06381_L01 CGGAGATCCTTTCAACCCGA 126 20 Nils Rostoks 2004-01-26 Illumina
ABC06381_R01 TCGGATGTCCGTCCAGATCA 656 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC06381_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes