Details of Primer Pair 'ABC06435_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC06435_L01R01414Nils Rostoks2004-01-26 ABC06435_L01 GAAGGTATGGCGTCGGCAAG 1065 20 Nils Rostoks 2004-01-26 Illumina
ABC06435_R01 ACCTACACAGCGCACACCCA 1478 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC06435_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes