Details of Primer Pair 'ABC06571_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC06571_L01R01490Nils Rostoks2004-01-26 ABC06571_L01 GTTGGCCAGGGAGCTGTCAT 375 20 Nils Rostoks 2004-01-26 Illumina
ABC06571_R01 ATAGTGCTGGCTGCACACGC 864 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC06571_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes