Details of Primer Pair 'ABC06618_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC06618_L01R01471Nils Rostoks2004-01-26 ABC06618_L01 TTCGCAGCGCACAGCATTAT 384 20 Nils Rostoks 2004-01-26 Illumina
ABC06618_R01 GGGCGGAAAATAGCGTCACA 854 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC06618_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes