Details of Primer Pair 'ABC06682_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC06682_L01R01524Nils Rostoks2004-01-26 ABC06682_L01 CGACAAGGACGTGCTGGAGA 319 20 Nils Rostoks 2004-01-26 Illumina
ABC06682_R01 GGCCTGCCTAGTCATGCACA 842 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC06682_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes