Details of Primer Pair 'ABC06725_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC06725_L01R01438Nils Rostoks2004-01-26 ABC06725_L01 CTTTTCCCACAAATCCCGCA 1181 20 Nils Rostoks 2004-01-26 Illumina
ABC06725_R01 AAGGCAAGCGTTGAAGCGAG 1618 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC06725_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes