Details of Primer Pair 'ABC06766_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC06766_L01R01467Nils Rostoks2004-01-26 ABC06766_L01 AGCTCCCATCGAGCTTGTGC 516 20 Nils Rostoks 2004-01-26 Illumina
ABC06766_R01 GTTCAGCGACAGCCAACGAA 982 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC06766_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes