Details of Primer Pair 'ABC06878_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC06878_L01R01448Nils Rostoks2004-01-26 ABC06878_L01 CCCACTACCCCGATAAGCCC 305 20 Nils Rostoks 2004-01-26 Illumina
ABC06878_R01 TTTGCACCCCTTGATTTGGC 752 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC06878_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes