Details of Primer Pair 'ABC06931_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC06931_L01R01495Nils Rostoks2004-01-26 ABC06931_L01 GCCCCTCTACAGCCTCGTCA 894 20 Nils Rostoks 2004-01-26 Illumina
ABC06931_R01 AGATCCAGTGCCCTTGCAGC 1388 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC06931_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes