Details of Primer Pair 'ABC06958_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC06958_L01R01494Nils Rostoks2004-01-26 ABC06958_L01 CAGCGTCGCATATGATTCCG 1716 20 Nils Rostoks 2004-01-26 Illumina
ABC06958_R01 CCAAGGGGGCCGAGTTTATT 2209 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC06958_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes