Details of Primer Pair 'ABC06992_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC06992_L01R01402Nils Rostoks2004-01-26 ABC06992_L01 ACGAGCCGGAGGTGATGTTC 1423 20 Nils Rostoks 2004-01-26 Illumina
ABC06992_R01 GGTGGCGCCAAAACAAACTC 1824 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC06992_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes