Details of Primer Pair 'ABC07010_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC07010_L01R01413Nils Rostoks2004-01-26 ABC07010_L01 GACTCTGTCGGGCAGCATGA 1037 20 Nils Rostoks 2004-01-26 Illumina
ABC07010_R01 CCCATAAATTGCGAGCGTGG 1449 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC07010_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes