Details of Primer Pair 'ABC07013_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC07013_L01R01448Nils Rostoks2004-01-26 ABC07013_L01 GCAGAGGTTCAGAGGCAGGC 981 20 Nils Rostoks 2004-01-26 Illumina
ABC07013_R01 TTTGAAGATCCGGGAGCCAA 1428 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC07013_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes