Details of Primer Pair 'ABC07035_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC07035_L01R01489Nils Rostoks2004-01-26 ABC07035_L01 AAGTTCTACGGTGGCGGGGT 300 20 Nils Rostoks 2004-01-26 Illumina
ABC07035_R01 GGCAATGCAGGAGCACAAGA 788 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC07035_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes