Details of Primer Pair 'ABC07096_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC07096_L01R01532Nils Rostoks2004-01-26 ABC07096_L01 AGCTGAAGGGCAACTGGCAC 899 20 Nils Rostoks 2004-01-26 Illumina
ABC07096_R01 GGAAGGCCGTCAACATCCAC 1430 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC07096_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes