Details of Primer Pair 'ABC07106_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC07106_L01R010Nils Rostoks2005-03-17 ABC07106_L01 GCGCTGTCTCTTCTATGTGC 0 20 Nils Rostoks 2005-03-17 Invitrogen
ABC07106_R01 AGGTGCTCCTAATCTGATGG 994 20 Nils Rostoks 2005-03-17 Invitrogen

Comment History of 'ABC07106_L01R01'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB