Details of Primer Pair 'ABC07112_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC07112_L01R01441Nils Rostoks2004-01-26 ABC07112_L01 ACCAGGACTTCGGCATGGAC 220 20 Nils Rostoks 2004-01-26 Illumina
ABC07112_R01 TTGGAATAGAAGCGGGCACC 660 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC07112_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes