Details of Primer Pair 'ABC07194_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC07194_L01R01438Nils Rostoks2004-01-26 ABC07194_L01 AGGTTGGCGGCTACAACGTG 423 20 Nils Rostoks 2004-01-26 Illumina
ABC07194_R01 GAGACCACACCAGCACGGC 860 19 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC07194_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes