Details of Primer Pair 'ABC07197_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC07197_L01R01413Nils Rostoks2004-01-26 ABC07197_L01 TTATGCCCCTTGAACACGCA 1497 20 Nils Rostoks 2004-01-26 Illumina
ABC07197_R01 CCCACCACTACCAGGGTTGC 1909 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC07197_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes