Details of Primer Pair 'ABC07301_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC07301_L01R01586Nils Rostoks2004-01-26 ABC07301_L01 AACGGAAACTCCAATGGCGA 1436 20 Nils Rostoks 2004-01-26 Illumina
ABC07301_R01 AGCCACAGCCATAGGGCAAA 2021 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC07301_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes