Details of Primer Pair 'ABC07305_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC07305_L01R01498Nils Rostoks2004-01-26 ABC07305_L01 TCAACGTTGCAAGGAAGCCA 943 20 Nils Rostoks 2004-01-26 Illumina
ABC07305_R01 TCCGACCATCGACCTGAACA 1440 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC07305_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes