Details of Primer Pair 'ABC07331_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC07331_L01R01401Nils Rostoks2004-01-26 ABC07331_L01 TTCCCAGCTTCCGTCAAAGC 714 20 Nils Rostoks 2004-01-26 Illumina
ABC07331_R01 AGCCTGGGTACCATCCCTGA 1114 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC07331_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes