Details of Primer Pair 'ABC07351_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC07351_L01R01558Nils Rostoks2004-01-26 ABC07351_L01 TACTCCCCCGGCGGACTTAT 922 20 Nils Rostoks 2004-01-26 Illumina
ABC07351_R01 CCCAGCTAGCAGCAAGGGAA 1479 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC07351_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes