Details of Primer Pair 'ABC07356_L02R02'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC07356_L02R02568Nils Rostoks2005-02-09 ABC07356_L02 ACACGGAGCCTTGATCTCGC 38 20 Nils Rostoks 2005-02-09 Operon
ABC07356_R02 AGGCCGAGCATCTTGGTGAG 605 20 Nils Rostoks 2005-02-09 Operon

Details of Primer Pair 'ABC07356_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC07356_L01R01479Nils Rostoks2004-01-26 ABC07356_L01 GGGCATCGACCACTGGAACT 1026 20 Nils Rostoks 2004-01-26 Illumina
ABC07356_R01 CCGTGCGCGACACAGACTAA 1504 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC07356_L02R02'

DateSubmitterComment
2005-02-09 Nils Rostoks Probeset differentially expressed between Golden Promise and Morex. Development of allele-specific SNP markers.

Comment History of 'ABC07356_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes