Details of Primer Pair 'ABC07359_L02R02'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC07359_L02R02592Nils Rostoks2004-05-27 ABC07359_L02 CGAATTTGGTCTACGATGGTGATA 625 24 Nils Rostoks 2004-05-27 Qiagen
ABC07359_R02 CTTGGCTAGGCTATGCACATGAT 1217 23 Nils Rostoks 2004-05-27 Qiagen

Details of Primer Pair 'ABC07359_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC07359_L01R01430Nils Rostoks2004-01-26 ABC07359_L01 ACACAGGCCGACCGATTTGT 746 20 Nils Rostoks 2004-01-26 Illumina
ABC07359_R01 CCACACCACACCACATCCTCA 1175 21 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC07359_L02R02'

DateSubmitterComment
2004-05-27 Nils Rostoks Preliminary experiment, many primers were designed from Contest contigs and do not match HarvEST contigs, contig orientation was not checked, sometimes primer start and fragment size could not be determined

Comment History of 'ABC07359_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes