Details of Primer Pair 'ABC07427_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC07427_L01R01427Nils Rostoks2004-01-26 ABC07427_L01 TCCGTGGCATACCTTCAGCA 644 20 Nils Rostoks 2004-01-26 Illumina
ABC07427_R01 TCTCCGAGATCTTGCCGGTC 1070 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC07427_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes