Details of Primer Pair 'ABC07434_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC07434_L01R01468Nils Rostoks2004-01-26 ABC07434_L01 GGTTGTCCGAGAATGGTGCC 1380 20 Nils Rostoks 2004-01-26 Illumina
ABC07434_R01 TGGAATGGCTTGAACCAGCA 1847 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC07434_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes