Details of Primer Pair 'ABC07448_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC07448_L01R01414Nils Rostoks2004-01-26 ABC07448_L01 TCCCTTCTCTCCGAGGACCC 355 20 Nils Rostoks 2004-01-26 Illumina
ABC07448_R01 CTCTCGTGCCTTGGCGAACT 768 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC07448_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes