Details of Primer Pair 'ABC07501_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC07501_L01R01459Nils Rostoks2004-01-26 ABC07501_L01 TGGGGCTGGCATTAGGAAGA 886 20 Nils Rostoks 2004-01-26 Illumina
ABC07501_R01 CAGCTACAGCGTCAGCGGAA 1344 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC07501_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes